Authors: Ahn DG, Kourakis MJ, Rohde LA, Silver LM, Ho RK

Title: T-box gene tbx5 is essential for formation of the pectoral limb bud.

Citation: Nature 2002 Jun 13;417(6890):754-8

Abstract: The T-box genes Tbx4 and Tbx5 have been shown to have key functions in the specification of the identity of the vertebrate forelimb (Tbx5) and hindlimb (Tbx4). Here we show that in zebrafish, Tbx5 has an additional early function that precedes the formation of the limb bud itself. Functional knockdown of zebrafish tbx5 through the use of an antisense oligonucleotide resulted in a failure to initiate fin bud formation, leading to the complete loss of pectoral fins. The function of the tbx5 gene in the development of zebrafish forelimbs seems to involve the directed migration of individual lateral-plate mesodermal cells into the future limb-bud-producing region. The primary defect seen in the tbx5-knockdown phenotype is similar to the primary defects described in known T-box-gene mutants such as the spadetail mutant of zebrafish and the Brachyury mutant of the mouse, which both similarly exhibit an altered migration of mesodermal cells. A common function for many of the T-box genes might therefore be in mediating the proper migration and/or changes in adhesive properties of early embryonic cells.

Organism: zebrafish

Delivery Method: Microinjection

First Oligo Name: anti-tbx5 -1

First Oligo Sequence: GAAAGGTGTCTTCACTGTCCGCCAT

First GenBank Number:

First Oligo Type: translational blocking-start

Second Oligo Name: anti-tbx5-2

Second Oligo Sequence: CCTGTACGATGTCTACCGTGAGGC

Second GenBank Number:

Second Oligo Type: translational block-UTR

Third Oligo Name: anti-tbx4

Third Oligo Sequence: CCAGAACGCAGTAATTTGTCCACTT

Third GenBank Number:

Third Oligo Type: control

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: