Authors: Arora, V and Iversen, P.L.

Title: Antisense oligonucleotides targeted to the p53 gene modulate rat liver regeneration

Citation: Drug Metab. And Disp. 2000. 28(2):131-138

Abstract: The rapidly proliferating cells of the regenerating liver after partial hepatectomy (PH) present a reproducible in vivo model to study the functional role of the tumor suppressor gene p53. The present study uses the rat 70% PH model along with systemic administration of three different structural types of antisense oligonucleotides (ODNs) designed to suppress p53 expression. We tested the hypothesis that antisense ODNs can inhibit the expression of p53, resulting in the loss of the G(1)-S cell cycle checkpoint and an altered pattern of liver regeneration. Intraperitoneal administration of 5 mg/kg/day antisense phosphorothioate ODN after 70% PH resulted in reduced expression of the p53 protein in the regenerating liver. There were concomitant increases in weight gain of remnant-regenerating liver and expression of proliferating cell nuclear antigen and p21(waf-1) compared with either saline or 5 mg/kg/day mispaired phosphorothioate ODN treatment. Flow cytometric analysis of DNA content of isolated hepatocytes revealed a reduction in the G(0)/G(1) cell population and accumulation of cells with more than 4n DNA in antisense-treated rats. The regenerating livers had significantly diminished cytochrome P-450 (CYP) enzyme activities. Rats treated with p53 antisense ODNs, but not saline or mispair ODN controls, had significantly elevated CYP activities. These observations functionally link the expression of p53 with diminished expression of several CYP isoforms in the liver regeneration model.

Organism: rats, Sprague Dawley

Delivery Method: in vivo: injection

First Oligo Name: p53T

First Oligo Sequence: TCAGTCTGAGTCAGGCCC

First GenBank Number: X13058

First Oligo Type: translational block-UTR

Second Oligo Name: OL(1)p53

Second Oligo Sequence: CCCTGCTCCCCCCTGGCTCC

Second GenBank Number:

Second Oligo Type: mis-pair control

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: