Publications Database

Live Help

Text chat with Gene Tools Customer Support biologists.

Online Store Login

Enter our online store to order Gene Tools products.

Navigation

Publications Search

Site Search

Zebrafish contract research and commercial licenses

For contract research using Morpholinos in zebrafish or to license Morpholinos for commercial use in zebrafish in the USA, contact Zygogen, Inc. See the Outside Resources box for more information.

Authors: Agathon A, Thisse B, Thisse C

Title: Morpholino knock-down of antivin1 and antivin2 upregulates nodal signaling

Citation: Genesis. 2001 Jul;30(3):178-82

Abstract: No abstract available

Organism: zebrafish

Delivery Method: Microinjection

First Oligo Name: MoAtv1

First Oligo Sequence: GAAGTCATCTTTTCAAGGTGCAGGA

First GenBank Number: AF172089

First Oligo Type: translational blocking-start

Second Oligo Name: MoAtv2

Second Oligo Sequence: AGCTGGATGAACAGAGCCAT

Second GenBank Number: AF132445

Second Oligo Type: translational blocking-start

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type:

Gene Tools, LLC
1001 Summerton Way
Philomath, OR 97370 USA

Ph.: (541) 929-7840 | Fax: (541) 929-7841
Site Map | Contact Us