Authors: Bai RY, Koester C, Ouyang T, Hahn SA, Hammerschmidt M, Peschel C, Duyster J

Title: SMIF, a Smad4-interacting protein that functions as a co-activator in TGF [beta] signalling

Citation: Nat Cell Biol 2002 Mar;4 (3):181-90

Abstract: Proteins of the transforming growth factor beta(TGFbeta) superfamily regulate diverse cellular responses, including cell growth and differentiation. After TGFbeta stimulation, receptor-associated Smads are phosphorylated and form a complex with the common mediator Smad4. Here, we report the cloning of SMIF, a ubiquitously expressed, Smad4-interacting transcriptional co-activator. SMIF forms a TGFbeta/bone morphogenetic protein 4 (BMP4)-inducible complex with Smad4, but not with others Smads, and translocates to the nucleus in a TGFbeta/BMP4-inducible and Smad4-dependent manner. SMIF possesses strong intrinsic TGFbeta-inducible transcriptional activity, which is dependent on Smad4 in mammalian cells and requires p300/CBP. A point mutation in Smad4 abolished binding to SMIF and impaired its activity in transcriptional assays. Overexpression of wild-type SMIF enhanced expression of TGFbeta/BMP regulated genes, whereas a dominant-negative SMIF mutant suppressed expression. Furthermore, dominant-negative SMIF is able to block TGFbeta-induced growth inhibition. In a knockdown approach with morpholino-antisense oligonucleotides targeting zebrafish SMIF, severe but distinct phenotypic defects were observed in zebrafish embryos. Thus, we propose that SMIF is a crucial activator of TGFbeta signalling.

Organism: zebrafish

Delivery Method: Microinjection

First Oligo Name: smif MO

First Oligo Sequence: CTGACCCGCTTTATTCACACACTCC

First GenBank Number:

First Oligo Type: translational block-UTR

Second Oligo Name: smif 4-mis

Second Oligo Sequence: CTGAgCCGCaTTATTgACACtCTCC

Second GenBank Number:

Second Oligo Type: mis-pair control

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: