Authors: Bota DA, Davies KJ

Title: Lon protease preferentially degrades oxidized mitochondrial aconitase by an ATP-stimulated mechanism

Citation: Nat Cell Biol 2002 Sep;4(9):674-680

Abstract: Mitochondrial aconitase is sensitive to oxidative inactivation and can aggregate and accumulate in many age-related disorders. Here we report that Lon protease, an ATP-stimulated mitochondrial matrix protein, selectively recognizes and degrades the oxidized, hydrophobic form of aconitase after mild oxidative modification, but that severe oxidation results in aconitase aggregation, which makes it a poor substrate for Lon. Similarly, a morpholino oligodeoxynucleotide directed against the lon gene markedly decreases the amount of Lon protein, Lon activity and aconitase degradation in WI-38 VA-13 human lung fibroblasts and causes accumulation of oxidatively modified aconitase. The ATP-stimulated Lon protease may be an essential defence against the stress of life in an oxygen environment. By recognizing minor oxidative changes to protein structure and rapidly degrading the mildly modified protein, Lon protease may prevent extensive oxidation, aggregation and accumulation of aconitase, which could otherwise compromise mitochondrial function and cellular viability. Aconitase is probably only one of many mitochondrial matrix proteins that are preferentially degraded by Lon protease after oxidative modification.

Organism: cell culture: human fibroblasts WI-38 VA-13

Delivery Method: Special Delivery

First Oligo Name: lon

First Oligo Sequence: CGTAGCCAGTGCTCGCCGCCATAGC

First GenBank Number: NM004793

First Oligo Type: translational blocking-start

Second Oligo Name: GT std control

Second Oligo Sequence: CCTCTTACCTCAGTTACAATTTATA

Second GenBank Number:

Second Oligo Type: negative control

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: