Authors: Branford WW, Yost HJ

Title: Lefty-dependent inhibition of nodal- and wnt-responsive organizer gene expression is essential for normal gastrulation

Citation: Curr Biol. 2002 Dec 23;12(24):2136-41

Abstract: During gastrulation, diffusible "organizer" signals, including members of the TGFbeta Nodal subfamily, pattern dorsal mesoderm and the embryonic axes. Simultaneously, negative regulators of these signals, including the Nodal inhibitor Lefty, an atypical TGFbeta factor, are induced by Nodal. This suggests that Lefty-dependent modulation of organizer signaling might regulate dorsal mesoderm patterning and axial morphogenesis. Here, Xenopus Lefty (Xlefty) function was blocked by injection of anti-Xlefty morpholino oligonucleotides (MO). Xlefty-deficient embryos underwent exogastrulation, an aberrant morphogenetic process not predicted from deregulation of the Nodal pathway alone. In the absence of Xlefty, both Nodal- (Xnr2, gsc, cer, Xbra) and Wnt-responsive (gsc, Xnr3) organizer gene expression expanded away from the dorsal blastopore lip. Conversely, coexpression of Xlefty with Nodal or Wnt reduced the ectopic expression of Nodal- (Xbra) and Wnt-responsive (Xnr3) genes in a dose-dependent manner. Furthermore, Xlefty expression in the ectodermal animal pole inhibited endogenous Nodal- and Wnt-responsive gene expression in distant mesoderm cells, indicating that Xlefty inhibition can spread from its source. We hypothesize that Xlefty negatively regulates the spatial extent of Nodal- and Wnt-responsive gene expression in the organizer and that this Xlefty-dependent inhibition is essential for normal organizer patterning and gastrulation.

Organism: Xenopus

Delivery Method: Microinjection

First Oligo Name: anti Xlefty MO

First Oligo Sequence: GATGTGACAGTCTACAGGGTGCAAG

First GenBank Number:

First Oligo Type:

Second Oligo Name: anti Xlefty2 MO

Second Oligo Sequence: GATGTGACACAGGGTGCAAGTGCCT

Second GenBank Number:

Second Oligo Type:

Third Oligo Name: sense Xlefty MO

Third Oligo Sequence: AGTGATAGGCACTTGCACCCTGTGT

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: