Authors: Chan J, Bayliss P.E., Wood J.M., Roberts T.M.

Title: Dissection of angiogenic signaling in zebrafish using a chemical genetic approach

Citation: Cancer Cell. 2002. 1(3):257-267

Abstract: Striking homology between signaling molecules in zebrafish and humans suggests that compounds known to inhibit human kinases may enable a chemical genetic approach to dissect signaling pathways in the zebrafish embryo. We tested this hypothesis using a vascular endothelial growth factor receptor inhibitor, PTK787/ZK222584. Zebrafish embryos treated with this compound lacked all major blood vessels. Overexpression of AKT/PKB, a putative effector of vascular endothelial growth factor signaling, allowed blood vessels to form in the presence of drug. Endothelial cell apoptosis induced by thedrug is prevented by increasing AKT/PKB activity, thus establishing the physiological relevance of AKT/PKB in the angiogenic process. This approach allowed us to examine the effects of blood flow and the role of endothelial signals in organogenesis.

Organism: zebrafish

Delivery Method: Microinjection

First Oligo Name: VEGF-A-3

First Oligo Sequence: TAAGAAAGCGAAGCTGCTGGGTATG

First GenBank Number:

First Oligo Type: translational block-UTR

Second Oligo Name:

Second Oligo Sequence:

Second GenBank Number:

Second Oligo Type:

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: