Live Help

Text chat with Gene Tools Customer Support biologists.


Online Store Login

Enter our online store to order Gene Tools products.

Publications Search

Site Search

Zebrafish contract research and commercial licenses

For contract research using Morpholinos in zebrafish or to license Morpholinos for commercial use in zebrafish in the USA, contact Zygogen, Inc. See the Outside Resources box for more information.

Publications Database

Childs S, Chen JN, Garrity DM, Fishman MC
Patterning of angiogenesis in the zebrafish embryo
Development. 2002 Feb;129(4):973-8
Little is known about how vascular patterns are generated in the embryo. The vasculature of the zebrafish trunk has an extremely regular pattern. One intersegmental vessel (ISV) sprouts from the aorta, runs between each pair of somites, and connects to the dorsal longitudinal anastomotic vessel (DLAV). We now define the cellular origins, migratory paths and cell fates that generate these metameric vessels of the trunk. Additionally, by a genetic screen we define one gene, out of bounds (obd), that constrains this angiogenic growth to a specific path. We have performed lineage analysis, using laser activation of a caged dye and mosaic construction to determine the origin of cells that constitute the ISV. Individual angioblasts destined for the ISVs arise from the lateral posterior mesoderm (LPM), and migrate to the dorsal aorta, from where they migrate between somites to their final position in the ISVs and dorsal longitudinal anastomotic vessel (DLAV). Cells of each ISV leave the aorta only between the ventral regions of two adjacent somites, and migrate dorsally to assume one of three ISV cell fates. Most dorsal is a T-shaped cell, based in the DLAV and branching ventrally; the second constitutes a connecting cell; and the third an inverted T-shaped cell, based in the aorta and branching dorsally. The ISV remains between somites during its ventral course, but changes to run mid-somite dorsally. This suggests that the pattern of ISV growth ventrally and dorsally is guided by different cues. We have also performed an ENU mutagenesis screen of 750 mutagenized genomes and identified one mutation, obd that disrupts this pattern. In obd mutant embryos, ISVs sprout precociously at abnormal sites and migrate anomalously in the vicinity of ventral somite. The dorsal extent of the ISV is less perturbed. Precocious sprouting can be inhibited in a VEGF morphant, but the anomalous site of origin of obd ISVs remains. In mosaic embryos, obd somite causes adjacent wild-type endothelial cells to assume the anomalous ISV pattern of obd embryos. Thus, the launching position of the new sprout and its initial trajectory are directed by inhibitory signals from ventral somites. Zebrafish ISVs are a tractable system for defining the origins and fates of vessels, and for dissecting elements that govern patterns of vessel growth.
zebrafish
Microinjection
VEGF
GTATCAAATAAACAACCAAGTTCAT
Gene Tools, LLC
1001 Summerton Way
Philomath, OR 97370 USA

Ph.: (541) 929-7840 | Fax: (541) 929-7841
Site Map | Contact Us