Authors: Ciruna B, Weidinger G, Knaut H, Thisse B, Thisse C, Raz E, Schier AF

Title: Production of maternal-zygotic mutant zebrafish by germ-line replacement

Citation: Proc Natl Acad Sci U S A. 2002 Nov 12;99(23):14919-24. Epub 2002 Oct 23.

Abstract: We report a generally applicable strategy for transferring zygotic lethal mutations through the zebrafish germ line. By using a morpholino oligonucleotide that blocks primordial germ cell (PGC) development, we generate embryos devoid of endogenous PGCs to serve as hosts for the transplantation of germ cells derived from homozygous mutant donors. Successful transfers are identified by the localization of specifically labeled donor PGCs to the region of the developing gonad in chimeric embryos. This strategy, which results in the complete replacement of the host germ line with donor PGCs, was validated by the generation of maternal and maternal-zygotic mutants for the miles apart locus. This germ-line replacement technique provides a powerful tool for studying the maternal effects of zygotic lethal mutations. Furthermore, the ability to generate large clutches of purely mutant embryos will greatly facilitate embryological, genetic, genomic, and biochemical studies.

Organism: zebrafish

Delivery Method: Microinjection

First Oligo Name: alpha-PGC MO

First Oligo Sequence: GCTGGGCATCCATGTCTCCGACCAT

First GenBank Number:

First Oligo Type: translational blocking-start

Second Oligo Name:

Second Oligo Sequence:

Second GenBank Number:

Second Oligo Type:

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: