Authors: Davidson G, Mao B, Del Barco Barrantes I, Niehrs C

Title: Kremen proteins interact with Dickkopf1 to regulate anteroposterior CNS patterning

Citation: Development. 2002 Dec;129(24):5587-96

Abstract: A gradient of Wnt/beta-catenin signalling formed by posteriorising Wnts and anteriorising Wnt antagonists regulates anteroposterior (AP) patterning of the central nervous system (CNS) during Xenopus gastrulation. In this process, the secreted Wnt antagonist Dkk1 functions in the Spemann organiser and its anterior derivatives by blocking Wnt receptors of the lipoprotein receptor-related protein (LRP) 5 and 6 class. In addition to LRP6, Dkk1 interacts with another recently identified receptor class, the transmembrane proteins Kremen1 (Krm1) and Kremen2 (Krm2) to synergistically inhibit LRP6. We have investigated the role of Krm1 and Krm2 during early Xenopus embryogenesis. Consistent with a role in zygotic Wnt inhibition, overexpressed Krm anteriorises embryos and rescues embryos posteriorised by Wnt8. Antisense morpholino oligonucleotide (Mo) knockdown of Krm1 and Krm2 leads to deficiency of anterior neural development. In this process, Krm proteins functionally interact with Dkk1: (1) in axis duplication assays krm2 synergises with dkk1 in inhibiting Wnt/LRP6 signalling; (2) krm2 rescues microcephalic embryos induced by injection of inhibitory anti-Dkk1 antibodies; and (3) injection of krm1/2 antisense Mo enhances microcephaly induced by inhibitory anti-Dkk1 antibodies. The results indicate that Krm proteins function in a Wnt inhibition pathway regulating early AP patterning of the CNS.

Organism: Xenopus

Delivery Method: Microinjection

First Oligo Name: krm1

First Oligo Sequence: TGAAATTGTCCAAATATCCATCACC

First GenBank Number:

First Oligo Type: translational blocking-start

Second Oligo Name: krm2

Second Oligo Sequence: ACCACAGCATCTCCACCAACATTGT

Second GenBank Number:

Second Oligo Type: translational blocking-start

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: