Authors: Deng J, Hua K, Lesser SS, Harp JB

Title: Activation of signal transducer and activator of transcription-3 during proliferative phases of 3T3-L1 adipogenesis

Citation: Endocrinology 2000 Jul;141(7):2370-6

Abstract: Signal transducer and activator of transcription-3 (STAT3) is abundantly expressed in preadipocytes and adipocytes, but little is known about its activation status or functional role during adipogenesis. In this report we investigate STAT3 activation in 3T3-L1 preadipocytes before and after differentiation into adipocytes. STAT3 was highly tyrosine phosphorylated and bound to DNA in proliferating preadipocytes, but not in growth-arrested preadipocytes or adipocytes. In growth-arrested confluent preadipocytes, induction of differentiation with methylisobutylxanthine, dexamethasone, and high dose insulin led to a delayed, but prolonged (3-day), increase in STAT3 tyrosine phosphorylation. This increase in STAT3 phosphorylation coincided temporally with postconfluent preadipocyte mitotic clonal expansion. Insulin and methylisobutylxanthine alone, but not dexamethasone, induced STAT3 tyrosine phosphorylation in postconfluent cells. Diminution of endogenous STAT3 expression by antisense morpholino oligonucleotides significantly decreased preconfluent preadipocyte proliferation. Collectively, these findings suggest a regulatory role for STAT3 during the proliferative phases of adipogenesis.

Organism: cell culture: 3T3-L1 preadipocytes

Delivery Method: Scrape Delivery

First Oligo Name: STAT3

First Oligo Sequence: TGGTTCCACTGAGCCATCCTGCTTGC

First GenBank Number:

First Oligo Type: translational blocking-start

Second Oligo Name: GT Std Control

Second Oligo Sequence: CCTCTTACCTCAGTTACAATTTATA

Second GenBank Number:

Second Oligo Type:

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: