Authors: Andermann P, Ungos J, Raible DW

Title: Neurogenin1 Defines Zebrafish Cranial Sensory Ganglia Precursors

Citation: Dev Biol. 2002 Nov 1;251(1):45-58

Abstract: Cells delaminate from epithelial placodes to form sensory ganglia in the vertebrate head. We describe the formation of cranial neurogenic placodes in the zebrafish, Danio rerio, using bHLH transcription factors as molecular markers. A single neurogenin gene, neurogenin1 (ngn1), is required for the development of all zebrafish cranial ganglia, which contrasts with other described vertebrates. Expression of ngn1 delineates zebrafish ganglionic placodes, including trigeminal, lateral line, and epibranchial placodes. In addition, ngn1 is expressed in a subset of cells within the otic vesicle that will delaminate to form the octaval (statoacoustic) ganglion. The trigeminal placode is the first to differentiate, and forms just lateral and adjacent to the neural crest. Expression of ngn1 is transient and prefigures expression of a related bHLH transcription factor, neuroD. Interfering with ngn1 function using a specific antisense morpholino oligonucleotide blocks differentiation of all cranial ganglia but not associated glial cells. Lateral line sensory neuromasts develop independently of ngn1 function, suggesting that two derivatives of lateral line placodes, ganglia and migrating primordia, are under separate genetic control.

Organism: zebrafish

Delivery Method: Microinjection

First Oligo Name: MO #1

First Oligo Sequence: ACGATCTCCATTGTTGATAACCTGG

First GenBank Number:

First Oligo Type:

Second Oligo Name: MO #2

Second Oligo Sequence: ACCTTATTGGTGGGCTGGGAGATGC

Second GenBank Number:

Second Oligo Type:

Third Oligo Name: 4 bp-mismatch

Third Oligo Sequence: TATtCGAaCTCCATTGTTcATAtCC

Third GenBank Number:

Third Oligo Type: 4-mis-pair control

Fourth Oligo Name:

Fourth Oligo Sequence: MO seq. identical to Cornell and Eisen 2002.

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: