Authors: Arora V, Hannah TL, Iversen PL, Brand RM

Title: Transdermal use of phosphorodiamidate morpholino oligomer AVI-4472 inhibits cytochrome P450 3A2 activity in male rats

Citation: Pharm Res. 2002 Oct;19(10):1465-70

Abstract: PURPOSE: To determine if dermal absorption of an antisense phosphorodiamidate Morpholino oligomers (PMO) can inhibit target gene expression in the liver in vivo. METHOD: Antisense PMO targeted to cytochrome P450 (CYP) 3A2 was applied topically to adult male rats at doses of 0.03, 0.3, and 3.0 mg. CYP3A enzyme activity in the underlying skin and liver was evaluated 24 h following application. RESULTS: Systemic PMO bioavailability was determined by detection of full-length PMO in liver and fluorescence micrography in underlying skin. CYP3A enzyme activity were measured by hydroxylation of 7-benzyloxy-4-(trifluoromethyl)-coumarin and data were expressed as nanomoles of product/ 100 microg S9 protein/h. A topical dose of 0.03 mg inhibited enzyme levels from 576 +/- 17 (vehicle) and 564 +/- 20 (control PMO) to 432 +/- 20 in the antisense-treated liver (p < 0.05). Increasing the dose to 0.3 mg further inhibited enzyme level to 278 +/- 13 (p < 0.005). The inhibition did not increase further when the dose was increased to 3 mg. In the skin, starting enzyme levels were approximately one third of the liver (171 +/- 9) and maximum inhibition was reached at a lower dose. Topical delivery of 0.03 mg led reduced skin enzyme levels in half to 89 +/- 32 (p < 0.05). Increasing the dose to 0.3 mg and 3.0 mg did not produce any further inhibition, at 73 8 and 72 +/- 17 respectively. CONCLUSION: Topical application of antisense PMO in rats is a feasible delivery strategy for gene targets in liver and underlying skin.

Organism: Sprague Dawley rats & hairless CRL:SK1 mice

Delivery Method: transdermal

First Oligo Name: AVI-4472

First Oligo Sequence: GAGCTGAAAGCAGGTCCATCCC

First GenBank Number: U09742

First Oligo Type:

Second Oligo Name:

Second Oligo Sequence:

Second GenBank Number:

Second Oligo Type:

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: