Live Help

Text chat with Gene Tools Customer Support biologists.


Online Store Login

Enter our online store to order Gene Tools products.

Publications Search

Site Search

Zebrafish contract research and commercial licenses

For contract research using Morpholinos in zebrafish or to license Morpholinos for commercial use in zebrafish in the USA, contact Zygogen, Inc. See the Outside Resources box for more information.

Publications Database

Araki I, Brand M
Morpholino-induced knockdown of Fgf8 efficiently phenocopies the acerebellar (ACE) phenotype
Genesis. 2001 Jul;30(3):157-9
No abstract available
zebrafish
Microinjection
MO-fgf8
GAGTCTCATGTTTATAGCCTCAGTA
translational blocking-start
4mis-fgf8 MO
GAGTCTgATcTTTtTAGCCaCAGT
4-mis-pair control
Gene Tools, LLC
1001 Summerton Way
Philomath, OR 97370 USA

Ph.: (541) 929-7840 | Fax: (541) 929-7841
Site Map | Contact Us