Authors: Basye J, Trent JO, Gao D, Ebbinghaus SW

Title: Triplex formation by morpholino oligodeoxyribonucleotides in the HER-2/neu promoter requires the pyrimidine motif

Citation: Nucleic Acids Res 2001 Dec 1;29(23):4873-80

Abstract: Triplex-forming oligonucleotides (TFOs) are good candidates to be used as site-specific DNA-binding agents. Two obstacles encountered with TFOs are susceptibility to nuclease activity and a requirement for magnesium for triplex formation. Morpholino oligonucleotides were shown in one study to form triplexes in the absence of magnesium. In the current study, we have compared phosphodiester and morpholino oligonucleotides targeting a homopurine-homopyrimidine region in the human HER2/neu promoter. Using gel mobility shift analysis, our data demonstrate that triplex formation by phosphodiester oligonucleotides at the HER-2/neu promoter target is possible with pyrimidine-parallel, purine-antiparallel and mixed sequence (GT)-antiparallel motifs. Only the pyrimidine-parallel motif morpholino TFO was capable of efficient triple helix formation, which required low pH. Triplex formation with the morpholino TFO was efficient in low or no magnesium. The pyrimidine motif TFOs with either a phosphodiester or morpholino backbone were able to form triple helices in the presence of potassium ions, but required low pH. We have rationalized the experimental observations with detailed molecular modeling studies. These data demonstrate the potential for the development of TFOs based on the morpholino backbone modification and demonstrate that the pyrimidine motif is the preferred motif for triple helix formation by morpholino oligonucleotides.

Organism: not applicable

Delivery Method: not applicable

First Oligo Name: HNPGA25 MO

First Oligo Sequence: gaggaggaggtggaggaggaagagg

First GenBank Number:

First Oligo Type:

Second Oligo Name: HNPGTap25MO

Second Oligo Sequence: tggtggtggtggtggtggttgtggt

Second GenBank Number:

Second Oligo Type:

Third Oligo Name: HNPGTp25MO

Third Oligo Sequence: tggtgttggtggtggtggtggtggt

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name: HNPCT25MO

Fourth Oligo Sequence: tcctcttcctcctcctcctcctcct

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: