Authors: Bauer H, Lele Z, Rauch GJ, Geisler R, Hammerschmidt M

Title: The type I serine/threonine kinase receptor Alk8/Lost-a-fin is required for Bmp2b/7 signal transduction during dorsoventral patterning of the zebrafish embryo

Citation: Development 2001 128(6):849-858

Abstract: Ventral specification of mesoderm and ectoderm depends on signaling by members of the bone morphogenetic protein (Bmp) family. Bmp signals are transmitted by a complex of type I and type II serine/threonine kinase transmembrane receptors. Here, we show that Alk8, a novel member of the Alk1 subgroup of type I receptors, is disrupted in zebrafish lost-a-fin (laf) mutants. Two alk8/laf null alleles are described. In laf(tm110), a conserved extracellular cysteine residue is replaced by an arginine, while in laf(m100), Alk8 is prematurely terminated directly after the transmembrane domain. The zygotic effect of both mutations leads to dorsalization of intermediate strength. A much stronger dorsalization, similar to that of bmp2b/swirl and bmp7/snailhouse mutants, however, is obtained by inhibiting both maternally and zygotically supplied alk8 gene products with morpholino antisense oligonucleotides. The phenotype of laf mutants and alk8 morphants can be rescued by injected mRNA encoding Alk8 or the Bmp-regulated transcription factor Smad5, but not by mRNA encoding Bmp2b or Bmp7. Conversely, injected mRNA encoding a constitutively active version of Alk8 can rescue the strong dorsalization of bmp2b/swirl and bmp7/snailhouse mutants, whereas smad5/somitabun mutant embryos do not respond. Altogether, the data suggest that Alk8 acts as a Bmp2b/7 receptor upstream of Smad5.

Organism: zebrafish

Delivery Method: Microinjection

First Oligo Name: alk8morph1

First Oligo Sequence: caactcctcaagtgactctcagcg

First GenBank Number:

First Oligo Type:

Second Oligo Name: alk8morph2

Second Oligo Sequence: gattcatgtttgtgttcaatttccg

Second GenBank Number:

Second Oligo Type:

Third Oligo Name: 4mm-alk8morph1

Third Oligo Sequence: caagtccacaagtgactgtcaccg

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name: bmp2bmorph

Fourth Oligo Sequence: cgcggaccacggcgaccatgatc

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: