Authors: Behra M, Cousin X, Bertrand C, Vonesch JL, Biellmann D, Chatonnet A, Strahle U

Title: Acetylcholinesterase is required for neuronal and muscular development in the zebrafish embryo

Citation: Nat Neurosci. 2002 Feb;5(2):111-8

Abstract: The neurotransmitter acetylcholine (ACh) has a crucial role in central and neuromuscular synapses of the cholinergic system. After release into the synaptic cleft, ACh is rapidly degraded by acetylcholinesterase (AChE). We have identified a mutation in the ache gene of the zebrafish, which abolishes ACh hydrolysis in homozygous animals completely. Embryos are initially motile but subsequently develop paralysis. Mutant embryos show defects in muscle fiber formation and innervation, and primary sensory neurons die prematurely. The neuromuscular phenotype in ache mutants is suppressed by a homozygous loss-of-function allele of the alpha-subunit of the nicotinic acetylcholine receptor (nAChR), indicating that the impairment of neuromuscular development is mediated by activation of nAChR in the mutant. Here we provide genetic evidence for non-classical functions of AChE in vertebrate development.

Organism: zebrafish

Delivery Method: Microinjection

First Oligo Name: MO-ache

First Oligo Sequence: CTGAGGTCTTCATGGCTTCTTTTCA

First GenBank Number:

First Oligo Type:

Second Oligo Name: MO-co

Second Oligo Sequence: CCATATCGGAGTATACGATCTCCAT

Second GenBank Number:

Second Oligo Type:

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: