Authors: Akagi K, Kyun Park E, Mood K, Daar IO

Title: Docking protein SNT1 is a critical mediator of fibroblast growth factor signaling during Xenopus embryonic development.

Citation: Dev Dyn. 2002 Mar;223(2):216-28.

Abstract: The docking protein SNT1/FRS2 (fibroblast growth factor receptor substrate 2) is implicated in the transmission of extracellular signals from several growth factor receptors to the mitogen-activated protein (MAP) kinase signaling cascade, but its biological function during development is not well characterized. Here, we show that the Xenopus homolog of mammalian SNT1/FRS-2 (XSNT1) plays a critical role in the appropriate formation of mesoderm-derived tissue during embryogenesis. XSNT1 has an expression pattern that is quite similar to the fibroblast growth factor receptor-1 (FGFR1) during Xenopus development. Ectopic expression of XSNT1 markedly enhanced the embryonic defects induced by an activated FGF receptor, and increased the MAP kinase activity as well as the expression of a mesodermal marker in response to FGF receptor signaling. A loss-of-function study using antisense XSNT1 morpholino oligonucleotides (XSNT-AS) shows severe malformation of trunk and posterior structures. Moreover, XSNT-AS disrupts muscle and notochord formation, and inhibits FGFR-induced MAP kinase activation. In ectodermal explants, XSNT-AS blocks FGFR-mediated induction of mesoderm and the accompanying elongation movements. Our results indicate that XSNT1 is a critical mediator of FGF signaling and is required for early Xenopus development.

Organism: Xenopus

Delivery Method: Microinjection

First Oligo Name: XSNT1-AS

First Oligo Sequence: GCTACAACAGCTACCCATTGCTTCT

First GenBank Number:

First Oligo Type: translational blocking-start

Second Oligo Name:

Second Oligo Sequence:

Second GenBank Number:

Second Oligo Type:

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: