Live Help

Text chat with Gene Tools Customer Support biologists.


Online Store Login

Enter our online store to order Gene Tools products.

Publications Search

Site Search

Zebrafish contract research and commercial licenses

For contract research using Morpholinos in zebrafish or to license Morpholinos for commercial use in zebrafish in the USA, contact Zygogen, Inc. See the Outside Resources box for more information.

Publications Database

Boonanuntanasarn S, Yoshizaki G, Takeuchi Y, Morita T, and Takeuchi T
Gene Knock-down in Rainbow Trout Embryos Using Antisense Morpholino Phosphorodiamidate Oligonucleotides
Marine Biotechnology 2002. 4:256-266
Gene knock-down technology using antisense molecules has many applications for studying gene function, disrupting undesirable genetic traits, as well as providing effective therapy for a number of viral diseases. Encouraged by these applications, we developed a gene knock-down technique to interfere with gene expression using transgenic rainbow trout expressing the green fluorescent protein (GFP) gene as a model. One of the antisense morpholino phosphorodiamidate oligonucleotides (AMOs) used in this study (AtGFP-1) was 25 nucleotides in length and localized against codons 2 to 8 of GFP messenger RNA. Microinjection of AtGFP-1 into the blastodisc of fertilized eggs decreased the level of GFP gene expression in a dose-dependent manner, A comparison of the effects of various doses of AtGFP-1 suggested that 10 ng of AtGFP-1 was the optimal concentration in that it interfered with specific gene expression without being strongly toxic to trout embryos. Conversely, morpholino phosphorodiamidate oligonucleotides with the inverted AtGFP-1 sequence, which cannot bind to the target mRNA, did not inhibit GFP gene expression. AtGFP-1 did not affect the expression of nontargeted genes such as the skeletal muscle actin and foreign lacZ genes. These results also indicate that AtGFP-1 interfered with the expression of only the targeted gene. Western blot and reverse transcriptase polymerase chain reaction analyses revealed that the amount of GFP protein drastically decreased whereas the mRNA level was not affected by AtGFP-1, suggesting that AtGFP-1 blocked specific gene function at the translational level. Further, this gene inhibition persisted until the hatching stage. Another AMO, which was localized against the junction region between the 5? untranslated region and the starting codon of GFP mRNA (AtGFP-2), also caused inhibition effects. Thus AMOs can have potent and specific gene knock-down effects in trout embryos. This technology may be useful for examining the roles of selected genes and disrupting their expression during embryonic development of salmonid fish.
rainbow trout
Microinjection
AtGFP-1
TGAACAGCTCCTCGCCCTTGCTCAC
AtGFP-2
CATGGTGGTACCGAATTCGGATCGG
invert AtGFP-1
CACTCGTTCCCGCTCCTCGACAAGT
Gene Tools, LLC
1001 Summerton Way
Philomath, OR 97370 USA

Ph.: (541) 929-7840 | Fax: (541) 929-7841
Site Map | Contact Us