Authors: Braun S, Hanselmann C, Gassmann MG, auf dem Keller U, Born-Berclaz C, Chan K, Kan YW, Werner S

Title: Nrf2 transcription factor, a novel target of keratinocyte growth factor action which regulates gene expression and inflammation in the healing skin wound

Citation: Mol Cell Biol. 2002 Aug;22(15):5492-505

Abstract: Keratinocyte growth factor (KGF) is a potent mitogen for epithelial cells, and it promotes survival of these cells under stress conditions. In a search for KGF-regulated genes in keratinocytes, we identified the gene encoding the transcription factor NF-E2-related factor 2 (Nrf2). Nrf2 is a key player in the cellular stress response. This might be of particular importance during wound healing, where large amounts of reactive oxygen species are produced as a defense against invading bacteria. Therefore, we studied the wound repair process in Nrf2 knockout mice. Interestingly, the expression of various key players involved in wound healing was significantly reduced in early wounds of the Nrf2 knockout animals, and the late phase of repair was characterized by prolonged inflammation. However, these differences in gene expression were not reflected by obvious histological abnormalities. The normal healing rate appears to be at least partially due to an up-regulation of the related transcription factor Nrf3, which was also identified as a target of KGF and which was coexpressed with Nrf2 in the healing skin wound. Taken together, our results reveal novel roles of the KGF-regulated transcription factors Nrf2 and possibly Nrf3 in the control of gene expression and inflammation during cutaneous wound repair.

Organism: cell culture: mouse primary keratinocytes

Delivery Method: Special Delivery

First Oligo Name: Nrf3

First Oligo Sequence: AGCTTCATCTCCCACGGTGCGCCG

First GenBank Number: nm_010903

First Oligo Type: translational blocking-start

Second Oligo Name: GT Std. Control

Second Oligo Sequence: CCTCTTACCTCAGTTACAATTTATA

Second GenBank Number:

Second Oligo Type: other

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: