Live Help

Text chat with Gene Tools Customer Support biologists.


Online Store Login

Enter our online store to order Gene Tools products.

Publications Search

Site Search

Zebrafish contract research and commercial licenses

For contract research using Morpholinos in zebrafish or to license Morpholinos for commercial use in zebrafish in the USA, contact Zygogen, Inc. See the Outside Resources box for more information.

Publications Database

Brent L, Drapeau P
Targeted 'knockdown' of channel expression in vivo with an antisense morpholino oligonucleotide
Neuroscience 2002 Oct 1;114(2):275
We have examined whether antisense morpholino oligonucleotides (morpholinos) can be used as a tool to suppress or "knockdown" the expression of ion channels during development of the zebrafish. Because the acetylcholine receptor channel is well characterized in zebrafish and is abundant as skeletal muscle is found throughout the body, we sought to knock down its expression as a general test of the feasibility of this approach. A 25-mer morpholino was designed to target the 5' region of the cloned alpha-subunit and was injected into early stage blastulae in order to trap it in all developing cells. From the time of hatching (early on the third day of development) and for a few days after, a fraction of the injected embryos were immobile, i.e. were "morphant". Injection of blastulae without the morpholino or with a control morpholino containing four mispaired bases did not affect the embryos. Although the morphant embryos were generally normal in appearance, they lacked staining with alpha-bungarotoxin or an alpha-subunit-specific monoclonal antibody. In whole muscle cell recordings from morphant embryos, miniature end-plate potentials were undetectable in many of the cells and in most they had a slower, immature time course. These results are consistent with a greatly reduced, dysfunctional level of expression of acetylcholine receptors in morphant embryos.Because of their stability and specificity, morpholinos should prove useful for targeted deletion of transmitter receptors and channels in developing zebrafish and possibly in other preparations.
zebrafish
Microinjection
nAChR alpha
TTCTGTTGATATGACTGGGAAAAGT
4mis nAChR alpha
TTCTcTTGAaATGACaGGGAtAAGT
Gene Tools, LLC
1001 Summerton Way
Philomath, OR 97370 USA

Ph.: (541) 929-7840 | Fax: (541) 929-7841
Site Map | Contact Us