Authors: Burgess S, Reim G, Chen W, Hopkins N, Brand M

Title: The zebrafish spiel-ohne-grenzen (spg) gene encodes the POU domain protein Pou2 related to mammalian Oct4 and is essential for formation of the midbrain and hindbrain, and for pre-gastrula morphogenesis

Citation: Development. 2002 Feb; 129(4):905-916

Abstract: n early embryonic development, the brain is divided into three main regions along the anteroposterior axis: the forebrain, midbrain and hindbrain. Through retroviral insertional mutagenesis and chemical mutagenesis experiments in zebrafish, we have isolated mutations that cause abnormal hindbrain organization and a failure of the midbrain-hindbrain boundary (MHB) to form, a region that acts as an organizer for the adjacent brain regions. The mutations fail to complement the spiel-ohne-grenzen (spg) mutation, which causes a similar phenotype, but for which the affected gene is unknown. We show through genetic mapping, cloning of the proviral insertion site and allele sequencing that spg mutations disrupt pou2, a gene encoding the Pou2 transcription factor. Based on chromosomal synteny, phylogenetic sequence comparison, and expression and functional data, we suggest that pou2 is the zebrafish ortholog of mouse Oct3/Oct4 and human POU5F1. For the mammalian genes, a function in brain development has so far not been described. In the absence of functional pou2, expression of markers for the midbrain, MHB and the hindbrain primordium (pax2.1, wnt1, krox20) are severely reduced, correlating with the neuroectoderm-specific expression phase of pou2. Injection of pou2 mRNA restores these defects in spg mutant embryos, but does not activate these markers ectopically, demonstrating a permissive role for pou2. Injections of pou2-morpholinos phenocopy the spg phenotype at low concentration, further proving that spg encodes pou2. Two observations suggest that pou2 has an additional earlier function: higher pou2-morpholino concentrations specifically cause a pre-gastrula arrest of cell division and morphogenesis, and expression of pou2 mRNA itself is reduced in spg-homozygous embryos at this stage. These experiments suggest two roles for pou2. Initially, Pou2 functions during early proliferation and morphogenesis of the blastomeres, similar to Oct3/4 in mammals during formation of the inner cell mass. During zebrafish brain formation, Pou2 then functions a second time to activate gene expression in the midbrain and hindbrain primordium, which is reflected at later stages in the specific lack in spg embryos of the MHB and associated defects in the mid- and hindbrain.

Organism: zebrafish

Delivery Method: Microinjection

First Oligo Name: anti-pou2 MO1

First Oligo Sequence: cgctctctccgtcatctttccgcta

First GenBank Number:

First Oligo Type:

Second Oligo Name: anti-pou2 MO2

Second Oligo Sequence: ttcaaacaagaaagcgtaaagactg

Second GenBank Number:

Second Oligo Type:

Third Oligo Name: GT Std Control

Third Oligo Sequence: cctcttacctcagttacaatttata

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: