Authors: Carl M, Loosli F, Wittbrodt J

Title: Six3 inactivation reveals its essential role for the formation and patterning of the vertebrate eye

Citation: Development. 2002 Sep;129(17):4057-63

Abstract: The establishment of retinal identity and the subsequent patterning of the optic vesicle are the key steps in early vertebrate eye development. To date little is known about the nature and interaction of the genes controlling these steps. So far few genes have been identified that, when over-expressed, can initiate ectopic eye formation. Of note is Six3, which is expressed exclusively in the anterior neural plate. However, 'loss of function' analysis has not been reported. Using medaka fish, we show that vertebrate Six3 is necessary for patterning of the anterior neuroectoderm including the retina anlage. Inactivation of Six3 function by morpholino knock-down results in the lack of forebrain and eyes. Corroborated by gain-of-function experiments, graded interference reveals an additional role of Six3 in the proximodistal patterning of the optic vesicle. During both processes of vertebrate eye formation, Six3 cooperates with Pax6.

Organism: medaka embryos

Delivery Method: Microinjection

First Oligo Name: MoGFP

First Oligo Sequence: CAGCTCCTCGCCCTTGCTCACCATG

First GenBank Number:

First Oligo Type:

Second Oligo Name: Mosix3t-GFP

Second Oligo Sequence: GTCCGCCGCCTGCCTTCCCACACGC

Second GenBank Number:

Second Oligo Type:

Third Oligo Name: MoSix3ct-GFP

Third Oligo Sequence: GaCCGCCGaCTGCCTaCCCtCACcA

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name: MoPax6t-GFP

Fourth Oligo Sequence: aATGATGCAGAACAGTCACAGTGGCG

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name: MoPax6ct-GFP

Fifth Oligo Sequence: ATaATGCAaAACAGTaACAaTGGaG

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: