Authors: Chen YH, Tsai HJ

Title: Treatment with Myf5-morpholino results in somite patterning and brain formation defects in zebrafish

Citation: Differentiation. 2002 Oct;70(8):447-56

Abstract: Myf-5 is a stage-dependent transcription factor associated with somitogenesis. To study its biological functions in zebrafish, we injected the Myf5-morpholinos ZMF-MO (antisense nucleotides 28 to 52) and ZMF-OTHER (antisense nucleotides 3 to 27) into zebrafish embryos to establish a myf-5 gene knockdown. No phenotypic abnormalities were observed following injection with 0.2 ng of ZMF-MO, but defects were displayed in 2 of 118 (1.7%) surviving embryos injected with 1 ng ZMF-MO. Morphological defects became more severe with increased dosages: 105 of 270 (38.9%) surviving embryos injected with 4.5 ng of ZMF-MO displayed such abnormalities as the absence of eyes or brains in addition to the following low-dosage defects in 24 hpf embryos: longitudinal yolk sacs, incomplete epiboly coverage, abnormal and suspended tail buds, diffused somite boundaries, and head shrinkage. Similar results were observed in the 4.5 ng ZMF-OTHER injection group. However, when fish were co-injected with 4.5 ng ZMF-MO and 4.5 ng myf-5 mRNA, abnormality rates decreased from 49.6% to 5.5%. Our results show that the brain krox20 gene was down-regulated at rhombomere 3; the pax2.1 gene was completely down-regulated; myoD was expressed normally; myogenin was substantially down-regulated in whole somites; and desmin was partly inhibited in newly forming somites. Our conclusion is that zebrafish Myf-5 may play important roles in brain formation and in the convergence and extension of shield epiblasts and tail buds during early embryogenesis, in addition to its well-understood role as a muscle regulatory factor in somites.

Organism: zebrafish

Delivery Method: Microinjection

First Oligo Name: ZMF-MO

First Oligo Sequence: TACGTCCATGATTGGTTTGGTGTTG

First GenBank Number:

First Oligo Type:

Second Oligo Name: ZMF-Other

Second Oligo Sequence: AAGGTTTCTGAGTGGTGTGGTTGCA

Second GenBank Number:

Second Oligo Type:

Third Oligo Name: Fl. chordin MO

Third Oligo Sequence: ATCCACAGCAGCCCCTCCATCATCC

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name: GT Std. Control

Fourth Oligo Sequence: CCTCTTACCTCAGTTACAATTTATA

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: