Live Help

Text chat with Gene Tools Customer Support biologists.


Online Store Login

Enter our online store to order Gene Tools products.

Publications Search

Site Search

Zebrafish contract research and commercial licenses

For contract research using Morpholinos in zebrafish or to license Morpholinos for commercial use in zebrafish in the USA, contact Zygogen, Inc. See the Outside Resources box for more information.

Publications Database

Collavin L, Kirschner MW
The secreted Frizzled-related protein Sizzled functions as a negative feedback regulator of extreme ventral mesoderm
Development. 2003 Feb;130(4):805-16
The prevailing model of dorsal ventral patterning of the amphibian embryo predicts that the prospective mesoderm is regionalized at gastrulation in response to a gradient of signals. This gradient is established by diffusible BMP and Wnt inhibitors secreted dorsally in the Spemann organizer. An interesting question is whether ventrolateral tissue passively reads graded levels of ventralizing signals, or whether local self-organizing regulatory circuits may exist on the ventral side to control cell behavior and differentiation at a distance from the Organizer. We provide evidence that sizzled, a secreted Frizzled-related protein expressed ventrally during and after gastrulation, functions in a negative feedback loop that limits allocation of mesodermal cells to the extreme ventral fate, with direct consequences for morphogenesis and formation of the blood islands. Morpholino-mediated knockdown of Sizzled protein results in expansion of ventral posterior mesoderm and the ventral blood islands, indicating that this negative regulation is required for proper patterning of the ventral mesoderm. The biochemical activity of sizzled is apparently very different from that of other secreted Frizzled-related proteins, and does not involve inhibition of Wnt8. Our data are consistent with the existence of some limited self-organizing properties of the extreme ventral mesoderm.
Xenopus
Microinjection
MOSZL
GAGGAGCAGGAAGACTCCGGTCATG
translational blocking-start
MOC
CCTCTTACCTCAGTTACAATTTATA
MOC2
GCAGACCTTGTTTAATGAACTCAAC
negative control
Gene Tools, LLC
1001 Summerton Way
Philomath, OR 97370 USA

Ph.: (541) 929-7840 | Fax: (541) 929-7841
Site Map | Contact Us