Authors: Cornell RA, Eisen JS

Title: Delta/Notch signaling promotes formation of zebrafish neural crest by repressing Neurogenin 1 function

Citation: Development. 2002 Jun;129(11):2639-48

Abstract: In zebrafish, cells at the lateral edge of the neural plate become Rohon-Beard primary sensory neurons or neural crest. Delta/Notch signaling is required for neural crest formation. ngn1 is expressed in primary neurons; inhibiting Ngn1 activity prevents Rohon-Beard cell formation but not formation of other primary neurons. Reducing Ngn1 activity in embryos lacking Delta/Notch signaling restores neural crest formation, indicating Delta/Notch signaling inhibits neurogenesis without actively promoting neural crest. Ngn1 activity is also required for later development of dorsal root ganglion sensory neurons; however, Rohon-Beard neurons and dorsal root ganglion neurons are not necessarily derived from the same precursor cell. We propose that temporally distinct episodes of Ngn1 activity in the same precursor population specify these two different types of sensory neurons.

Organism: zebrafish

Delivery Method: Microinjection

First Oligo Name: ngn1 MO

First Oligo Sequence: TATACGATCTCCATTGTTGATAACC

First GenBank Number:

First Oligo Type:

Second Oligo Name: ngn1mismatch MO

Second Oligo Sequence: TATtCGAaCTCCATTGTTcATAtCC

Second GenBank Number:

Second Oligo Type:

Third Oligo Name: ngn15'UTR MO

Third Oligo Sequence: ACCTTATTGGTGGGCTGGGAGATGC

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: