Authors: Dahmane N, Sanchez P, Gitton Y, Palma V, Sun T, Beyna M, Weiner H and Altaba AR

Title: The Sonic Hedgehog-Gli pathway regulates dorsal brain growth and tumorigenesis

Citation: Development 2001 128:5201-5212

Abstract: The mechanisms that regulate the growth of the brain remain unclear. We show that Sonic hedgehog (Shh) is expressed in a layer-specific manner in the perinatal mouse neocortex and tectum, whereas the Gli genes, which are targets and mediators of SHH signaling, are expressed in proliferative zones. In vitro and in vivo assays show that SHH is a mitogen for neocortical and tectal precursors and that it modulates cell proliferation in the dorsal brain. Together with its role in the cerebellum, our findings indicate that SHH signaling unexpectedly controls the development of the three major dorsal brain structures. We also show that a variety of primary human brain tumors and tumor lines consistently express the GLI genes and that cyclopamine, a SHH signaling inhibitor, inhibits the proliferation of tumor cells. Using the in vivo tadpole assay system, we further show that misexpression of GLI1 induces CNS hyperproliferation that depends on the activation of endogenous Gli1 function. SHH-GLI signaling thus modulates normal dorsal brain growth by controlling precursor proliferation, an evolutionarily important and plastic process that is deregulated in brain tumors.

Organism: Xenopus

Delivery Method: Microinjection

First Oligo Name: frog Gli1

First Oligo Sequence: CGGGCGGACACTGGCGGGACGC

First GenBank Number:

First Oligo Type: translational blocking-start

Second Oligo Name: frog Gli2

Second Oligo Sequence: GCACAGAACGCAGGTAATGCTCCAT

Second GenBank Number:

Second Oligo Type: translational blocking-start

Third Oligo Name: frog Shh

Third Oligo Sequence: GAGATTCGAGTTCGCAACCAGCATC

Third GenBank Number:

Third Oligo Type: translational blocking-start

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: