Authors: Darken RS, Scola AM, Rakeman AS, Das G, Mlodzik M, Wilson PA

Title: The planar polarity gene strabismus regulates convergent extension movements in Xenopus

Citation: EMBO J. 2002 Mar; 21(5):976-985

Abstract: The signaling mechanisms that specify, guide and coordinate cell behavior during embryonic morphogenesis are poorly understood. We report that a Xenopus homolog of the Drosophila planar cell polarity gene strabismus (stbm) participates in the regulation of convergent extension, a critical morphogenetic process required for the elongation of dorsal structures in vertebrate embryos. Overexpression of Xstbm, which is expressed broadly in early development and subsequently in the nervous system, causes severely shortened trunk structures; a similar phenotype results from inhibiting Xstbm translation using a morpholino antisense oligo. Experiments with Keller explants further demonstrate that Xstbm can regulate convergent extension in both dorsal mesoderm and neural tissue. The specification of dorsal tissues is not affected. The Xstbm phenotype resembles those obtained with several other molecules with roles in planar polarity signaling, including Dishevelled and Frizzled-7 and -8. Unlike these proteins, however, Stbm has little effect on conventional Wnt/beta-catenin signaling in either frog or fly assays. Thus our results strongly support the emerging hypothesis that a vertebrate analog of the planar polarity pathway governs convergent extension movements.

Organism: Xenopus

Delivery Method: Microinjection

First Oligo Name: Xstbm

First Oligo Sequence: CGTTGGCGGATTTGGGTCCCCCCGA

First GenBank Number:

First Oligo Type:

Second Oligo Name: 4-mispair Xstbm

Second Oligo Sequence: CGTTaGCGGtTTTGGcTCCCaCCGA

Second GenBank Number:

Second Oligo Type: 4-mis-pair control

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: