Authors: Deardorff MA, Tan C, Saint-Jeannet JP, Klein PS

Title: A role for frizzled 3 in neural crest development.

Citation: Development 2001 Oct 1;128(19):3655-3663

Abstract: Wnts are a large family of secreted molecules implicated in numerous developmental processes. Frizzled proteins are likely receptors for Wnts and are required for Wnt signaling in invertebrates. A large number of vertebrate frizzled genes have also been identified, but their roles in mediating specific responses to endogenous Wnts have not been well defined. Using a functional assay in Xenopus, we have performed a large screen to identify potential interactions between Wnts and frizzleds. We find that signaling by Xwnt1, but not other Wnts, can be specifically enhanced by frizzled 3 (Xfz3). As both Xfz3 and Xwnt1 are highly localized to dorsal neural tissues that give rise to neural crest, we examined whether Xfz3 mediates Xwnt1 signaling in the formation of neural crest. Xfz3 specifically induces neural crest in ectodermal explants and in embryos, similar to Xwnt1, and at lower levels of expression, synergizes with Xwnt1 in neural crest induction. Furthermore, loss of Xfz3 function, either by depletion with a Xfz3-directed morpholino antisense oligonucleotide or by expression of an inhibitory form of Xfz3 (Nfz3), prevents Xwnt1-dependent neural crest induction in ectodermal explants and blocks neural crest formation in whole embryos. These results show that Xfz3 is required for Xwnt1 signaling in the formation of the neural crest in the developing vertebrate embryo.

Organism: Xenopus

Delivery Method: Microinjection

First Oligo Name: Xfz3

First Oligo Sequence: CGCAAAGCCACATGCACCTCTTGAA

First GenBank Number:

First Oligo Type:

Second Oligo Name:

Second Oligo Sequence:

Second GenBank Number:

Second Oligo Type:

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: