Authors: Devi GR, Oldenkamp JR, London CA, Iversen PL

Title: Inhibition of human chorionic gonadotropin beta-subunit modulates the mitogenic effect of c-myc in human prostate cancer cells

Citation: Prostate. 2002 Nov 1;53(3):200-10

Abstract: BACKGROUND: Amplification of the proto-oncogene c-myc has been identified as one of the most common genetic alterations in prostate cancer, thus making it an attractive therapeutic target. However, certain prostate cancer cells are unresponsive to c-Myc inhibition. The purpose of this study was to test the hypothesis that effective growth inhibition in the refractory cancer cells can be achieved by blocking c-myc along with a growth factor using a novel phosphorodiamidate morpholino antisense oligomer-based approach. Human chorionic gonadotropin, a growth factor implicated in neoplasm, causes activation of c-myc through a G-protein-coupled pathway of signal transduction. METHODS: In this study, the effect of inhibition of beta-hCG and c-myc singly or in combination was evaluated in DU145 (RB -/-, p53-/-, androgen-independent) and LNCaP (Rb+/+, p53 +/+, androgen-sensitive) human prostate cancer cell lines and in a DU145 subcutaneous xenograft murine model. RESULTS: Antisense phosphorodiamidate morpholino oligomers directed against beta-hCG and c-myc caused a specific decrease of the target protein levels. Unlike LNCaP cells, DU145 cell growth was refractory to c-Myc inhibition. Unresponsiveness to c-myc inhibition in DU145 cells was overcome by targeting both beta-hCG and c-myc genes, resulting in potentiation of the antiproliferative effect seen with inhibition of beta-hCG alone. CONCLUSIONS: The inhibition of beta-hCG sensitizes prostate cancer cells to the antiproliferative effects of c-Myc inhibition, including tumors that are refractory to c-Myc decrease alone.

Organism: cultures & mice: human DU145, PC-3, LNCaP prostate cancer lines, male athymic (Ncr nu/nu) mice

Delivery Method: culture: scrape loading and syringe loading; mouse: IP injection

First Oligo Name: c-myc start

First Oligo Sequence: ACGTTGAGGGGCATCGTCGC

First GenBank Number:

First Oligo Type: translational blocking-start

Second Oligo Name: c-myc 4mis

Second Oligo Sequence: ACtgTGAGGGGCATCGctGC

Second GenBank Number:

Second Oligo Type: mis-pair control

Third Oligo Name: beta-hCG start

Third Oligo Sequence: CCATCCTTGTGTCGTCCCCTG

Third GenBank Number:

Third Oligo Type: translational blocking-start

Fourth Oligo Name: beta-hCG 4mis

Fourth Oligo Sequence: CacctCTgtGgtCtgCCCCgt

Fourth GenBank Number:

Fourth Oligo Type: negative control

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: