Authors: Dibner C, Elias S, Frank D

Title: XMeis3 protein activity is required for proper hindbrain patterning in Xenopus laevis embryos

Citation: Development. 2001 Sep;128(18):3415-26

Abstract: Meis-family homeobox proteins have been shown to regulate cell fate specification in vertebrate and invertebrate embryos. Ectopic expression of RNA encoding the Xenopus Meis3 (XMeis3) protein caused anterior neural truncations with a concomitant expansion of hindbrain and spinal cord markers in Xenopus embryos. In naive animal cap explants, XMeis3 activated expression of posterior neural markers in the absence of pan-neural markers. Supporting its role as a neural caudalizer, XMeis3 is expressed in the hindbrain and spinal cord. We show that XMeis3 acts like a transcriptional activator, and its caudalizing effects can be mimicked by injecting RNA encoding a VP16-XMeis3 fusion protein. To address the role of endogenous XMeis3 protein in neural patterning, XMeis3 activity was antagonized by injecting RNA encoding an Engrailed-XMeis3 antimorph fusion protein or XMeis3 antisense morpholino oligonucleotides. In these embryos, anterior neural structures were expanded and posterior neural tissues from the midbrain-hindbrain junction through the hindbrain were perturbed. In neuralized animal cap explants, XMeis3-antimorph protein modified caudalization by basic fibroblast growth factor and Wnt3a. XMeis3-antimorph protein did not inhibit caudalization per se, but re-directed posterior neural marker expression to more anterior levels; it reduced expression of spinal cord and hindbrain markers, yet increased expression of the more rostral En2 marker. These results provide evidence that XMeis3 protein in the hindbrain is required to modify anterior neural-inducing activity, thus, enabling the transformation of these cells to posterior fates.

Organism: Xenopus

Delivery Method: Microinjection

First Oligo Name: XMeis

First Oligo Sequence: CTCATCATACCTTTGTGCCATTCCG

First GenBank Number:

First Oligo Type:

Second Oligo Name: GT Std Control

Second Oligo Sequence: CCTCTTACCTCAGTTACAATTTATA

Second GenBank Number:

Second Oligo Type:

Third Oligo Name:

Third Oligo Sequence:

Third GenBank Number:

Third Oligo Type:

Fourth Oligo Name:

Fourth Oligo Sequence:

Fourth GenBank Number:

Fourth Oligo Type:

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: