Authors: Arora V, Cate ML, Ghosh C, Iversen PL

Title: Phosphorodiamidate Morpholino Antisense Oligomers Inhibit Expression of Human Cytochrome P450 3A4 and Alter Selected Drug Metabolism

Citation: Drug Metab Dispos. 2002 Jul 1;30(7):757-762

Abstract: Antisense phosphorodiamidate morpholino oligomers (PMO) inhibit targeted gene expression by preventing ribosomal assembly, thus preventing translation. Inhibition of cytochrome P450 (P450) 3A4 expression was examined in primary human hepatocytes from 11 donors and in Caco-2 cells (stably transfected with CYP3A4 cDNA on an extrachromosomal vector) by evaluating the metabolism of substrate 7-benzyloxy-4-[trifluoromethyl]-coumarin and Western immunoblot analysis. Cellular uptake of PMO was confirmed in both cell systems using fluorescein-labeled PMOs. Three antisense PMO sequences and two control PMO sequences were tested. AVI-4557, a 20-mer PMO with the sequence 5'-CTGGGATGAGAGCCATCACT-3' was selected as the optimal agent. AVI-4557 inhibited expression of CYP3A4 in Caco-2/h3A4 cells by 64% at 24 h following administration of 2.8 microM by an assisted delivery protocol. Inhibition of CYP3A activity was observed in primary human hepatocytes after 24 h exposure to AVI-4557 by an average of 32 +/- 11%. Furthermore, AVI-4557 exposure resulted in a sequence-dependent inhibition of cyclophosphamide-related cytocidal activity and a sequence-dependent induction of paclitaxel-related cytocidal activity in both cell types. Finally, the cytocidal activity of cisplatin was not affected with AVI-4557 treatment in either cell type. These studies indicate AVI-4557 is an effective and specific inhibitor of CYP3A4 expression.

Organism: cell culture: hepatocytes (human primary cells), Caco-2/h3A4 cells

Delivery Method: Special Delivery

First Oligo Name: AVI-4557

First Oligo Sequence: CTGGGATGAGAGCCATCACT

First GenBank Number: m14096

First Oligo Type: translational blocking-start

Second Oligo Name: 1-0-556

Second Oligo Sequence: CTGGGATGAGAGCCATCAC

Second GenBank Number: m14096

Second Oligo Type: translational blocking-start

Third Oligo Name: 1-0-558

Third Oligo Sequence: GTCTGGGATGAGAGCCATCAC

Third GenBank Number: m14096

Third Oligo Type: translational blocking-start

Fourth Oligo Name: avi-4472

Fourth Oligo Sequence: GAGCTGAAAGCAGGTCCATCCC

Fourth GenBank Number: u09742

Fourth Oligo Type: negative control

Fifth Oligo Name:

Fifth Oligo Sequence:

Fifth GenBank Number:

Fifth Oligo Type:

Sixth Oligo Name:

Sixth Oligo Sequence:

Sixth GenBank Number:

Sixth Oligo Type:

Seventh Oligo Name:

Seventh Oligo Sequence:

Seventh GenBank Number:

Seventh Oligo Type:

Eighth Oligo Name:

Eighth Oligo Sequence:

Eighth GenBank Number:

Eighth Oligo Type: