Live Help

Text chat with Gene Tools Customer Support biologists.


Online Store Login

Enter our online store to order Gene Tools products.

Publications Search

Site Search

Zebrafish contract research and commercial licenses

For contract research using Morpholinos in zebrafish or to license Morpholinos for commercial use in zebrafish in the USA, contact Zygogen, Inc. See the Outside Resources box for more information.

Publications Database

Arora V, Knapp DC, Reddy MT, Weller DD, Iversen PL.
Bioavailability and efficacy of antisense morpholino oligomers targeted to c-myc and cytochrome P-450 3A2 following oral administration in rats
J Pharm Sci. 2002 Apr;91(4):1009-18
Antisense phosphorodiamidate Morpholino oligomers (PMO) are resistant to degradation by cellular hydrolases, DNases, RNases, and phosphodiesterases, but remain sensitive to prolonged exposure to low pH. The present studies evaluate the oral fractional bioavailability, stability, and efficacy of two distinct PMO sequences targeted to c-myc and cytochrome P-450 (CYP) 3A2. The c-myc antisense 20-mer, AVI-4126 (5'-ACGTTGAGGGGCATCGTCGC-3'), slowed the regenerative process in the rat liver after a 70% partial hepatectomy (PH). Rats were administered 3.0 mg/kg AVI-4126 in 0.1 mL saline via a bolus intravenous injection or in 0.5 mL sterile phosphate-buffered saline via gavage immediately following PH. The areas under the plasma concentration versus time curves revealed a fractional oral availability of 78.8% over a period of 10 min through 24 h. Immunoblot analysis of liver tissue from rats treated orally with AVI-4126 demonstrated a sequence-specific reduction in the target protein c-Myc, as well as secondary proliferation markers: proliferating cell nuclear antigen (PCNA), cyclin D1, and p53. The CYP3A2 antisense 22-mer AVI-4472 (5'-GAGCTGAAAGCAGGTCCATCCC-3') caused a sequence-dependent reduction of approximately five-fold in the rat liver CYP3A2 protein levels and erythromycin demethylation activity in 24 h following oral administration at a dose of 2 mg/kg. It is concluded that oral administration of PMOs can inhibit c-myc and CYP3A2 gene expression in rat liver by an antisense-based mechanism of action. These studies highlight the potential for development of PMOs as orally administered therapeutic agents. Copyright 2002 Wiley-Liss, Inc. and the American Pharmaceutical Association J Pharm Sci 91:1009-1018, 2002
rats, Sprague Dawley
in vivo: injection
c-myc AVI-4126
ACGTTGAGGGGCATCGTCGC
translational blocking-start
CYP3A2 AVI-4472
GAGCTGAAAGCAGGTCCATCCC
translational blocking-start
Gene Tools, LLC
1001 Summerton Way
Philomath, OR 97370 USA

Ph.: (541) 929-7840 | Fax: (541) 929-7841
Site Map | Contact Us